| Detail of EST/Unigene CO517142 |
| Acc. | CO517142 |
| Internal Acc. | s13dSG33A0800065_474368 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=4e-41; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-40; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=4e-40; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=5e-40; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=6e-40; |
| Length | 521 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | ATGGGAAAAACATATGACTAAGACAGCCCAATAAATATTCTGAACTCATGCACAAGAGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822391 |
| Trichome-related Gene from Literature | N/A |