Detail of EST/Unigene CO517254 |
Acc. | CO517254 |
Internal Acc. | s13dSG32F0700063_486104 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP24 10A, chloroplastic OS=Solanum lycopersicum E-value=8e-58; Chlorophyll a-b binding protein CP24, chloroplastic OS=Spinacia oleracea E-value=4e-57; Chlorophyll a-b binding protein CP24 10B, chloroplastic OS=Solanum lycopersicum E-value=3e-56; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=2e-08; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=2e-08; |
Length | 455 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | ATATCCAACATTAGAACATGAATTAAATTTGTCATGGAGTAGCACACTTAGGAAAAAGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838151 |
Trichome-related Gene from Literature | N/A |