| Detail of EST/Unigene CO653678 |
| Acc. | CO653678 |
| Internal Acc. | 122d10 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-2 OS=Arabidopsis thaliana E-value=4e-27; Hexokinase-1 OS=Arabidopsis thaliana E-value=1e-25; Hexokinase-2 OS=Oryza sativa subsp. japonica E-value=6e-25; Hexokinase-2 OS=Solanum tuberosum E-value=1e-24; Hexokinase-1 OS=Solanum tuberosum E-value=3e-24; |
| Length | 301 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | HL_HIF_HSS; |
| Sequence | ACGTATAAGTCAATTTTGGGGAGGTGGAGCTTGCGAAAATTTTTAGAGGTCTAGATATCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
| EC | 2.7.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816505 |
| Trichome-related Gene from Literature | N/A |