| Detail of EST/Unigene CO653944 |
| Acc. | CO653944 |
| Internal Acc. | 082c05 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=8e-38; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=4e-37; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=2e-36; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=2e-36; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=9e-36; |
| Length | 232 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | HL_HIF_HSS; |
| Sequence | ATAGGTTAACCTGGACTTCAGTTCTGAAGCTGACATGATCAGAAAATTCCGTGCTGGTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828409 |
| Trichome-related Gene from Literature | 828409 |