Detail of EST/Unigene CV016026 |
Acc. | CV016026 |
Internal Acc. | tbt_010979 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=7e-25; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-25; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=4e-24; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-23; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=3e-23; |
Length | 367 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_NNT (1 ESTs); |
Sequence | AAAACACTTACTTCTCCTTGCTAAACCATGGCTGCTTCTACAATGGCTGTCTCTTCCCCT |
EST members of Unigene | CV016026 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839870 |
Trichome-related Gene from Literature | 839870 |