Detail of EST/Unigene CV016171 |
Acc. | CV016171 |
Internal Acc. | tbt_007283 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=8e-51; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=7e-49; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=2e-48; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=2e-48; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-48; |
Length | 409 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_NNT (1 ESTs); |
Sequence | TACGCGGGGTCTCACGAGTATCATTCCACTACATGGCTGCTTCTACAATGGCTCTTACTT |
EST members of Unigene | CV016171 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |