| Detail of EST/Unigene CV016311 |
| Acc. | CV016311 |
| Internal Acc. | tbt_002939 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-79; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=6e-79; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=5e-78; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=5e-78; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=9e-78; |
| Length | 567 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_NNT (1 ESTs); |
| Sequence | TTGGGCATTTCAAACCATCAAACACTCACTTTTCTTTTCAAAATAAAACCATGGCTGCTG |
| EST members of Unigene | CV016311 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |