| Detail of EST/Unigene CV016814 |
| Acc. | CV016814 |
| Internal Acc. | tbt_002431 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=3e-75; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=8e-74; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=2e-73; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=2e-73; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=3e-73; |
| Length | 503 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_NNT (1 ESTs); |
| Sequence | CAACATCTTTCTGTGTAGTACTGCATTCAGAGTTTCATCTTCTTTCTATAATGGCAGCTG |
| EST members of Unigene | CV016814 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |