| Detail of EST/Unigene CV021430 |
| Acc. | CV021430 |
| Internal Acc. | tbt_002067 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=4e-50; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=3e-49; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-49; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=5e-49; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-49; |
| Length | 346 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_NNT (1 ESTs); |
| Sequence | GTCTCTTCTGGTACCCCATGGTTGGTCCTGACCGTGTCAAGTACTTGGGCCCATTCTCTG |
| EST members of Unigene | CV021430 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |