Detail of EST/Unigene CV021430 |
Acc. | CV021430 |
Internal Acc. | tbt_002067 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=4e-50; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=3e-49; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-49; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=5e-49; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-49; |
Length | 346 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_NNT (1 ESTs); |
Sequence | GTCTCTTCTGGTACCCCATGGTTGGTCCTGACCGTGTCAAGTACTTGGGCCCATTCTCTG |
EST members of Unigene | CV021430 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |