Detail of EST/Unigene CX516585 |
Acc. | CX516585 |
Internal Acc. | s13dNF01A07VI053_359259 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-77; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=8e-77; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-76; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=1e-76; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-76; |
Length | 577 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GAAATTCGGCGAGGCTGTGTGGTTCAAGGCAGGATCTCAAATCTTTAGTGAGGGAGGACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |