Detail of EST/Unigene CX516653 |
Acc. | CX516653 |
Internal Acc. | s13dNF03B08VI073_390315 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycerol-3-phosphate acyltransferase, chloroplastic OS=Pisum sativum E-value=1e-47; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Phaseolus vulgaris E-value=9e-43; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Carthamus tinctorius E-value=3e-39; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=4e-37; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Spinacia oleracea E-value=1e-34; |
Length | 533 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CATATCTATCCTATGGCAATACTGTGCCATGACATAATGCCCCCTCCACTAAAGGTTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840112 |
Trichome-related Gene from Literature | N/A |