| Detail of EST/Unigene CX516653 |
| Acc. | CX516653 |
| Internal Acc. | s13dNF03B08VI073_390315 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycerol-3-phosphate acyltransferase, chloroplastic OS=Pisum sativum E-value=1e-47; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Phaseolus vulgaris E-value=9e-43; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Carthamus tinctorius E-value=3e-39; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=4e-37; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Spinacia oleracea E-value=1e-34; |
| Length | 533 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CATATCTATCCTATGGCAATACTGTGCCATGACATAATGCCCCCTCCACTAAAGGTTGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840112 |
| Trichome-related Gene from Literature | N/A |