Detail of EST/Unigene CX516767 |
Acc. | CX516767 |
Internal Acc. | s13dNF08A01VI005_390543 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase delta chain, chloroplastic OS=Pisum sativum E-value=1e-34; ATP synthase delta chain, chloroplastic OS=Nicotiana tabacum E-value=3e-22; ATP synthase delta chain, chloroplastic OS=Spinacia oleracea E-value=4e-15; ATP synthase delta chain, chloroplastic OS=Sorghum bicolor E-value=2e-12; ATP synthase delta chain, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-06; |
Length | 315 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GCCGATTTAGCCAAATCCAACAACACCCTCGACGCCACCACTGCAGACATCGACAAAATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.3.14 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826551 |
Trichome-related Gene from Literature | N/A |