| Detail of EST/Unigene CX516792 |
| Acc. | CX516792 |
| Internal Acc. | s13dNF08D01VI014_390593 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Early light-induced protein, chloroplastic OS=Pisum sativum E-value=1e-29; Desiccation stress protein DSP-22, chloroplastic OS=Craterostigma plantagineum E-value=8e-08; Low molecular mass early light-inducible protein HV60, chloroplastic OS=Hordeum vulgare E-value=3e-07; Low molecular mass early light-inducible protein HV90, chloroplastic OS=Hordeum vulgare E-value=5e-07; |
| Length | 321 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | ATCATGTCTAGCTCCATTACAAGCAGCATTTCTAGCAGGCCTAGAGTTAACCAATTTAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821855 |
| Trichome-related Gene from Literature | N/A |