Detail of EST/Unigene CX516792 |
Acc. | CX516792 |
Internal Acc. | s13dNF08D01VI014_390593 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Early light-induced protein, chloroplastic OS=Pisum sativum E-value=1e-29; Desiccation stress protein DSP-22, chloroplastic OS=Craterostigma plantagineum E-value=8e-08; Low molecular mass early light-inducible protein HV60, chloroplastic OS=Hordeum vulgare E-value=3e-07; Low molecular mass early light-inducible protein HV90, chloroplastic OS=Hordeum vulgare E-value=5e-07; |
Length | 321 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ATCATGTCTAGCTCCATTACAAGCAGCATTTCTAGCAGGCCTAGAGTTAACCAATTTAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821855 |
Trichome-related Gene from Literature | N/A |