Detail of EST/Unigene CX516795 |
Acc. | CX516795 |
Internal Acc. | s13dNF08D04VI042_390599 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=5e-48; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=4e-41; Carbonic anhydrase 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-41; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=5e-40; Carbonic anhydrase 2 (Fragment) OS=Flaveria linearis E-value=1e-39; |
Length | 280 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | AGAGTCTGCCCATCTCATGTGCTAGACTTCCAGCCAGGAGAAGCTTTTGTGGTCAGAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821134 |
Trichome-related Gene from Literature | N/A |