Detail of EST/Unigene CX516802 |
Acc. | CX516802 |
Internal Acc. | s13dNF08D11VI094_390613 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=2e-37; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=1e-32; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=2e-22; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=6e-22; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Silene pratensis E-value=8e-22; |
Length | 254 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GCTCAGCAGCTGTTGTTAAACAAACTCCTTTCCTTGGTCAAAGGAAGGGTGCTGCCAACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |