Detail of EST/Unigene CX516806 |
Acc. | CX516806 |
Internal Acc. | s13dNF08E06VI051_390621 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit IV B, chloroplastic OS=Nicotiana sylvestris E-value=3e-10; Photosystem I reaction center subunit IV A, chloroplastic OS=Nicotiana sylvestris E-value=2e-09; Photosystem I reaction center subunit IV A, chloroplastic OS=Arabidopsis thaliana E-value=9e-07; Photosystem I reaction center subunit IV, chloroplastic OS=Spinacia oleracea E-value=3e-06; |
Length | 228 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CTGCAGCTTCAGGGTTTGTGTTGTCACCTAATAATGTTTCAGGCAACACAAACACAAATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828996 |
Trichome-related Gene from Literature | N/A |