| Detail of EST/Unigene CX516806 |
| Acc. | CX516806 |
| Internal Acc. | s13dNF08E06VI051_390621 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit IV B, chloroplastic OS=Nicotiana sylvestris E-value=3e-10; Photosystem I reaction center subunit IV A, chloroplastic OS=Nicotiana sylvestris E-value=2e-09; Photosystem I reaction center subunit IV A, chloroplastic OS=Arabidopsis thaliana E-value=9e-07; Photosystem I reaction center subunit IV, chloroplastic OS=Spinacia oleracea E-value=3e-06; |
| Length | 228 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CTGCAGCTTCAGGGTTTGTGTTGTCACCTAATAATGTTTCAGGCAACACAAACACAAATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828996 |
| Trichome-related Gene from Literature | N/A |