| Detail of EST/Unigene CX516812 |
| Acc. | CX516812 |
| Internal Acc. | s13dNF08F01VI015_390633 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin F-type, chloroplastic OS=Pisum sativum E-value=6e-37; Thioredoxin F2, chloroplastic OS=Arabidopsis thaliana E-value=3e-35; Thioredoxin F-type, chloroplastic OS=Mesembryanthemum crystallinum E-value=3e-34; Thioredoxin F1, chloroplastic OS=Arabidopsis thaliana E-value=3e-33; Thioredoxin F-type, chloroplastic OS=Spinacia oleracea E-value=4e-33; |
| Length | 300 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | AAGAGTGGGAGTTTCAGTGTAAGATCAAGCTTGGAAACTACGGGCCCCACCGTGACTGTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831501 |
| Trichome-related Gene from Literature | N/A |