| Detail of EST/Unigene CX516880 |
| Acc. | CX516880 |
| Internal Acc. | s13dNF09F08VI075_398231 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cystathionine gamma-synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-80; Cystathionine gamma-lyase OS=Dictyostelium discoideum E-value=1e-37; Cystathionine gamma-lyase OS=Sus scrofa E-value=1e-34; Cystathionine beta-lyase OS=Coxiella burnetii (strain RSA 493 / Nine Mile phase I) E-value=1e-33; Cystathionine gamma-lyase OS=Rattus norvegicus E-value=1e-33; |
| Length | 537 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CTTTGAAGTTGATCTCAGAAATTCGAATTTTGCATCATATTTTGGGCGGTGCTCTTAACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01758 cystathionine gamma-lyase |
| EC | 4.4.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821292 |
| Trichome-related Gene from Literature | N/A |