Detail of EST/Unigene CX516955 |
Acc. | CX516955 |
Internal Acc. | s13dNF05F11VI095_398381 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=5e-67; Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=2e-65; Chlorophyll a-b binding protein 1B-21, chloroplastic OS=Hordeum vulgare Ib-21 E-value=1e-61; Chlorophyll a-b binding protein 1B-20, chloroplastic (Fragment) OS=Hordeum vulgare Ib-20 E-value=1e-18; Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=5e-18; |
Length | 463 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | TCCATCACTTCTTTCTTCCTCAAAATCAAGATTTTCAACTTCACTTCCACTTCCTTGTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824654 |
Trichome-related Gene from Literature | N/A |