| Detail of EST/Unigene CX517066 |
| Acc. | CX517066 |
| Internal Acc. | s13dNF12B05VI045_398603 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=8e-98; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-73; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=4e-73; Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=1e-72; |
| Length | 547 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | GGAACCTCAAGATTCACCATGGGAAATGAATTGTGGTATGGACCAGACAGAGTGAAATAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835515 |
| Trichome-related Gene from Literature | N/A |