Detail of EST/Unigene CX517158 |
Acc. | CX517158 |
Internal Acc. | s13dNF14D01VI014_398787 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=3e-54; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=6e-51; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=1e-50; Glycine cleavage system H protein, mitochondrial (Fragment) OS=Flaveria pubescens E-value=2e-50; Probable glycine cleavage system H protein 2, mitochondrial OS=Arabidopsis thaliana E-value=1e-49; |
Length | 466 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | TATTATTTGTACTCTTATCACAAACACAACACAAAGAAGCAGAAGTAGTCTTAACAATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840141 |
Trichome-related Gene from Literature | N/A |