| Detail of EST/Unigene CX517523 |
| Acc. | CX517523 |
| Internal Acc. | s13dNF15D10VI090_400065 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 6, choloroplastic OS=Arabidopsis thaliana E-value=8e-88; Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-72; Linoleate 13S-lipoxygenase 3-1, chloroplastic OS=Solanum tuberosum E-value=7e-71; Lipoxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=8e-69; Putative lipoxygenase 5 OS=Oryza sativa subsp. japonica E-value=2e-66; |
| Length | 573 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CTTACAAGAGCATGTGGAGATTTGATTTGGAGTCTCTCCCAGCAGATCTTATTCGAAGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | ; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08021 arachidonate 12-lipoxygenase (R-type); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
| EC | 1.13.11.- 1.13.11.33 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843077 |
| Trichome-related Gene from Literature | N/A |