Detail of EST/Unigene CX517528 |
Acc. | CX517528 |
Internal Acc. | s13dNF15E05VI039_400075 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Aspartate aminotransferase OS=Aquifex aeolicus (strain VF5) E-value=1e-10; Aspartate aminotransferase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=1e-08; Aspartate aminotransferase OS=Pinus pinaster E-value=3e-08; Aspartate aminotransferase OS=Pyrococcus abyssi (strain GE5 / Orsay) E-value=3e-08; Aspartate aminotransferase OS=Thermus aquaticus E-value=5e-08; |
Length | 348 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GTCCTTCCAAATGACTGGCATTACCAATATACTAGTTGGTCCCGGTAACCCGGAAACACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
EC | 2.6.1.5 4.4.1.14 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844376 |
Trichome-related Gene from Literature | N/A |