| Detail of EST/Unigene CX517578 |
| Acc. | CX517578 |
| Internal Acc. | s13dNF18C10VI082_400711 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Plastid-lipid-associated protein, chloroplastic OS=Citrus unshiu E-value=3e-38; Chromoplast-specific carotenoid-associated protein, chromoplast OS=Cucumis sativus E-value=4e-36; Light-induced protein, chloroplastic OS=Solanum tuberosum E-value=5e-36; Light-induced protein, chloroplastic OS=Solanum demissum E-value=5e-36; Plastid lipid-associated protein 1, chloroplastic OS=Brassica campestris E-value=2e-35; |
| Length | 560 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CCTAAACCAACTTCTCCATACAAACACTCTTCCAGTAACCTCTCTCAACTCCACACCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825714 |
| Trichome-related Gene from Literature | N/A |