Detail of EST/Unigene CX517664 |
Acc. | CX517664 |
Internal Acc. | s13dNF17E11VI087_418401 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Tu, chloroplastic OS=Pisum sativum E-value=4e-40; Elongation factor Tu, chloroplastic OS=Arabidopsis thaliana E-value=2e-38; Elongation factor Tu, chloroplastic OS=Glycine max E-value=1e-37; Elongation factor Tu, chloroplastic OS=Glycine max E-value=1e-37; Elongation factor TuB, chloroplastic OS=Nicotiana sylvestris E-value=3e-35; |
Length | 534 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GGAAGACATTCACCTTTCTTTGCTGGTTATAGGCCTCAGTTTTACATGAGAACTACAGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.5.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827784 |
Trichome-related Gene from Literature | N/A |