| Detail of EST/Unigene CX517665 |
| Acc. | CX517665 |
| Internal Acc. | s13dNF17E12VI099_418403 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=2e-77; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=4e-77; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=6e-77; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-76; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=1e-76; |
| Length | 570 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CTTCATTTTCAATAGAGCTATTTATTTGCATTTAACTAAGTTGCAAATAAAATACTAGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |