| Detail of EST/Unigene CX517783 |
| Acc. | CX517783 |
| Internal Acc. | s13dNF25B04VI041_420235 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyllide a oxygenase, chloroplastic OS=Arabidopsis thaliana E-value=2e-92; Chlorophyllide a oxygenase, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-91; Chlorophyllide a oxygenase, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-60; Chlorophyllide a oxygenase, chloroplastic OS=Dunaliella salina E-value=2e-55; |
| Length | 619 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CGAGATTGTCATGGAACTTCCGGTTGAACACGGCTTACTTTTGGACAACCTTTTGGATCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841029 |
| Trichome-related Gene from Literature | N/A |