| Detail of EST/Unigene CX517811 |
| Acc. | CX517811 |
| Internal Acc. | s13dNF25E06VI051_420291 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein 3, chloroplastic OS=Spinacia oleracea E-value=7e-42; 30S ribosomal protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=4e-38; 30S ribosomal protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-36; 30S ribosomal protein 3, chloroplastic OS=Hordeum vulgare E-value=1e-34; Probable 30S ribosomal protein 3, chloroplastic OS=Mesostigma viride E-value=3e-21; |
| Length | 586 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CTCTTTCTCTGGTTCTGTTCTTTCATTCACTTCAACATTCGACAGAATCGAATCCAACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843189 |
| Trichome-related Gene from Literature | N/A |