Detail of EST/Unigene CX517853 |
Acc. | CX517853 |
Internal Acc. | s13dNF26A12VI097_420375 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Tryptophan synthase beta chain 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-50; Tryptophan synthase beta chain 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-49; Tryptophan synthase beta chain 2, chloroplastic OS=Camptotheca acuminata E-value=4e-48; Tryptophan synthase beta chain 1 (Fragment) OS=Zea mays E-value=5e-48; Tryptophan synthase beta chain 2, chloroplastic (Fragment) OS=Zea mays E-value=2e-47; |
Length | 547 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ATCTGCTGCAGGATGATGATGGACAAATTGTTGAGCCTCACTCTATTAGTGCAGGCTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835571 |
Trichome-related Gene from Literature | N/A |