| Detail of EST/Unigene CX517853 |
| Acc. | CX517853 |
| Internal Acc. | s13dNF26A12VI097_420375 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Tryptophan synthase beta chain 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-50; Tryptophan synthase beta chain 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-49; Tryptophan synthase beta chain 2, chloroplastic OS=Camptotheca acuminata E-value=4e-48; Tryptophan synthase beta chain 1 (Fragment) OS=Zea mays E-value=5e-48; Tryptophan synthase beta chain 2, chloroplastic (Fragment) OS=Zea mays E-value=2e-47; |
| Length | 547 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | ATCTGCTGCAGGATGATGATGGACAAATTGTTGAGCCTCACTCTATTAGTGCAGGCTTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835571 |
| Trichome-related Gene from Literature | N/A |