Detail of EST/Unigene CX517905 |
Acc. | CX517905 |
Internal Acc. | s13dNF26F06VI059_420479 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=0; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=0; |
Length | 580 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CTGGAGAGTTCCCAGGTGACTACGGATGGGACACTGCTGGACTTTCTGCTGACCCAGAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |