| Detail of EST/Unigene CX518063 |
| Acc. | CX518063 |
| Internal Acc. | s13dNF31F04VI043_421839 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide cyclase 4, chloroplastic OS=Arabidopsis thaliana E-value=1e-56; Allene oxide cyclase 3, chloroplastic OS=Arabidopsis thaliana E-value=5e-56; Allene oxide cyclase 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-53; Allene oxide cyclase 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-52; |
| Length | 612 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | GAGTTCTTTGAAAATGATTTCTTCCCTCAACCTTTCTACCTCTCCTCTTCAAACTCAAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837888 |
| Trichome-related Gene from Literature | N/A |