Detail of EST/Unigene CX518121 |
Acc. | CX518121 |
Internal Acc. | s13dNF27C12VI086_421955 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase DHAR3, chloroplastic OS=Arabidopsis thaliana E-value=4e-67; Glutathione S-transferase DHAR2 OS=Arabidopsis thaliana E-value=2e-49; Glutathione S-transferase DHAR1, mitochondrial OS=Arabidopsis thaliana E-value=1e-46; Putative glutathione S-transferase DHAR4 OS=Arabidopsis thaliana E-value=1e-40; Chloride intracellular channel protein 6 OS=Oryctolagus cuniculus E-value=4e-13; |
Length | 626 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CACAAACGTTACCAATGTCCACCGTTAGAATTCAAGTTTCAGCATGCGCTCTTTCCGCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
|
Corresponding NCBI Gene | 831532 |
Trichome-related Gene from Literature | N/A |