Detail of EST/Unigene CX518198 |
Acc. | CX518198 |
Internal Acc. | s13dNF28C01VI002_422109 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Spinacia oleracea E-value=5e-69; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=4e-68; Transketolase, chloroplastic OS=Zea mays E-value=8e-67; Transketolase, chloroplastic OS=Solanum tuberosum E-value=2e-63; Transketolase 7 OS=Craterostigma plantagineum E-value=2e-57; |
Length | 523 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CTTAACCAGAAGAGACCCTCAATTCTGGCCCTTTCTCGGCAAAAGTTGCCTAACCTTCCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819137 |
Trichome-related Gene from Literature | N/A |