| Detail of EST/Unigene CX518469 |
| Acc. | CX518469 |
| Internal Acc. | s13dNF32D01VI010_423771 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=2e-16; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=7e-15; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=7e-14; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=7e-12; Nudix hydrolase 13, mitochondrial OS=Arabidopsis thaliana E-value=4e-09; |
| Length | 505 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | GTTACATGTTCCCTCTACTTGTTCAAGAGGAATTGGAGTTCTGGCCTGAACAAAACCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838051 |
| Trichome-related Gene from Literature | N/A |