Detail of EST/Unigene CX518524 |
Acc. | CX518524 |
Internal Acc. | s13dNF33A08VI065_423881 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-hydroxyisoflavanone synthase OS=Glycine max E-value=2e-83; Licodione synthase OS=Glycyrrhiza echinata E-value=2e-60; Cytochrome P450 93A3 OS=Glycine max E-value=2e-40; Cytochrome P450 93A1 OS=Glycine max E-value=2e-39; Beta-amyrin 24-hydroxylase OS=Glycine max E-value=2e-38; |
Length | 579 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ACGAATCAGATGTTCAGAATCTTCCATACATTCGCGCCATGGTGAAGGAGGTATTCCGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |