| Detail of EST/Unigene CX518524 |
| Acc. | CX518524 |
| Internal Acc. | s13dNF33A08VI065_423881 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 2-hydroxyisoflavanone synthase OS=Glycine max E-value=2e-83; Licodione synthase OS=Glycyrrhiza echinata E-value=2e-60; Cytochrome P450 93A3 OS=Glycine max E-value=2e-40; Cytochrome P450 93A1 OS=Glycine max E-value=2e-39; Beta-amyrin 24-hydroxylase OS=Glycine max E-value=2e-38; |
| Length | 579 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | ACGAATCAGATGTTCAGAATCTTCCATACATTCGCGCCATGGTGAAGGAGGTATTCCGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830693 |
| Trichome-related Gene from Literature | 830693 |