Detail of EST/Unigene CX518614 |
Acc. | CX518614 |
Internal Acc. | s13dNF34A09VI069_424061 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase delta chain, chloroplastic OS=Pisum sativum E-value=1e-59; ATP synthase delta chain, chloroplastic OS=Nicotiana tabacum E-value=6e-44; ATP synthase delta chain, chloroplastic OS=Spinacia oleracea E-value=3e-34; ATP synthase delta chain, chloroplastic OS=Sorghum bicolor E-value=2e-29; ATP synthase delta chain, chloroplastic OS=Chlamydomonas reinhardtii E-value=9e-18; |
Length | 525 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CTCATCCTATCCCGCACCACCTTCACCTCCCCAAAACTCAAACTCTCCAAAACCAAACCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.3.14 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826551 |
Trichome-related Gene from Literature | N/A |