Detail of EST/Unigene CX518699 |
Acc. | CX518699 |
Internal Acc. | s13dNF36A08VI065_438618 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=2e-26; Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=1e-25; Thioredoxin M5, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-22; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=5e-22; Thioredoxin M-type, chloroplastic OS=Triticum aestivum E-value=5e-21; |
Length | 434 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ATCCACAAGTGCTGAAAAACCTGACTGCACTTTCCACAAACTATTGAGTAGAAGAATTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 5.3.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839436 |
Trichome-related Gene from Literature | N/A |