| Detail of EST/Unigene CX518728 |
| Acc. | CX518728 |
| Internal Acc. | s13dNF36D10VI090_438676 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamyl-tRNA(Gln) amidotransferase subunit A, chloroplastic/mitochondrial OS=Sorghum bicolor E-value=2e-55; Glutamyl-tRNA(Gln) amidotransferase subunit A, chloroplastic/mitochondrial OS=Oryza sativa subsp. japonica E-value=4e-55; Glutamyl-tRNA(Gln) amidotransferase subunit A, chloroplastic/mitochondrial OS=Oryza sativa subsp. indica E-value=4e-55; Glutamyl-tRNA(Gln) amidotransferase subunit A, chloroplastic/mitochondrial OS=Zea mays E-value=2e-54; Glutamyl-tRNA(Gln) amidotransferase subunit A, chloroplastic/mitochondrial OS=Vitis vinifera E-value=6e-54; |
| Length | 592 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CTGGTTACTATGATGCATATTACAAACGAGCGCAGCAGGTGAGAACCATTATAAGGAATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00632 Benzoate degradation via CoA ligation > K01426 amidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01426 amidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K01426 amidase |
| EC | 3.5.1.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822154 |
| Trichome-related Gene from Literature | N/A |