Detail of EST/Unigene CX518756 |
Acc. | CX518756 |
Internal Acc. | s13dNF36G10VI084_438732 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=2e-83; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=3e-40; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=5e-40; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=6e-40; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=8e-40; |
Length | 573 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | TTTTGGTCTAAGCAAGAAGCCCGAAGACTTTGCCAAATATCAAGGATATGAGTTGATTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826626 |
Trichome-related Gene from Literature | N/A |