| Detail of EST/Unigene CX518877 |
| Acc. | CX518877 |
| Internal Acc. | s13dNF38C08VI066_438974 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Adenylyl-sulfate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-57; Adenylyl-sulfate kinase, chloroplastic OS=Catharanthus roseus E-value=1e-54; Adenylyl-sulfate kinase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-52; Adenylyl-sulfate kinase OS=Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / LMG 5710 / VKM B-1787) E-value=1e-40; Probable adenylyl-sulfate kinase OS=Bacillus halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125) E-value=3e-40; |
| Length | 493 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | CTGGAATCAATGAAATGCTTTTAGTTTGTTAATATCGGTACATAGATAAAACAAGTGGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00860 adenylylsulfate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00860 adenylylsulfate kinase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00860 adenylylsulfate kinase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00958 sulfate adenylyltransferase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00958 sulfate adenylyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00958 sulfate adenylyltransferase |
| EC | 2.7.1.25 2.7.7.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821077 |
| Trichome-related Gene from Literature | N/A |