Detail of EST/Unigene CX519024 |
Acc. | CX519024 |
Internal Acc. | s13dNF35B06VI057_439268 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=1e-51; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=3e-51; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=9e-50; Alternative oxidase 1, mitochondrial OS=Glycine max E-value=3e-47; Alternative oxidase 1b, mitochondrial OS=Arabidopsis thaliana E-value=9e-45; |
Length | 523 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GTTTTCGTCGTTTTGGATCGAAGATGATGATGAGGCATGGTGGTGCTATGAACACTGCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821806 |
Trichome-related Gene from Literature | N/A |