Detail of EST/Unigene CX519035 |
Acc. | CX519035 |
Internal Acc. | s13dNF35C07VI054_439290 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit V, chloroplastic OS=Arabidopsis thaliana E-value=4e-47; Photosystem I reaction center subunit V, chloroplastic OS=Hordeum vulgare E-value=6e-38; Photosystem I reaction center subunit V, chloroplastic OS=Spinacia oleracea E-value=1e-26; Photosystem I reaction center subunit V, chloroplastic OS=Tortula ruralis E-value=5e-17; Photosystem I reaction center subunit V (Fragment) OS=Pisum sativum E-value=1e-12; |
Length | 542 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ATTAACAACCACCATTCAAAAACACAAAACTCACAATCTCAAGCCATCAAGCTTATCCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842016 |
Trichome-related Gene from Literature | N/A |