| Detail of EST/Unigene CX519207 |
| Acc. | CX519207 |
| Internal Acc. | s13dNF42E08VI067_442466 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=1e-34; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=7e-32; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-31; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=3e-31; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=2e-24; |
| Length | 472 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | GGTTTAAGAGCCTATGTTGGTAACTTGCCATGGGACGTTGACAATTCTAGCTTGGAGCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828579 |
| Trichome-related Gene from Literature | N/A |