Detail of EST/Unigene CX519736 |
Acc. | CX519736 |
Internal Acc. | s13dNF52B01VI009_443524 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-78; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-78; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=2e-77; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=2e-77; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-77; |
Length | 422 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | ATCTTACCTCACGGGAGAATTTCCTGGTGATTATGGTTGGGATACTGCTGGGCTTTCTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |