Detail of EST/Unigene CX519786 |
Acc. | CX519786 |
Internal Acc. | s13dNF52F10VI091_443624 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-58; Thioredoxin-like 2-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-55; Thioredoxin-like 2-2, chloroplastic OS=Arabidopsis thaliana E-value=8e-55; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-32; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=6e-30; |
Length | 605 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | CTTTTCATAGCATAGCATTTACACCTTCATTCATTCTCTTTTGTGTAAGTGTAAATGGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828722 |
Trichome-related Gene from Literature | N/A |