| Detail of EST/Unigene CX519863 |
| Acc. | CX519863 |
| Internal Acc. | s13dNF53F12VI103_443778 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Small heat shock protein, chloroplastic OS=Petunia hybrida E-value=8e-13; 25.3 kDa heat shock protein, chloroplastic OS=Arabidopsis thaliana E-value=1e-11; Small heat shock protein, chloroplastic OS=Triticum aestivum E-value=3e-11; Small heat shock protein, chloroplastic (Fragment) OS=Glycine max E-value=4e-11; Small heat shock protein, chloroplastic OS=Solanum lycopersicum E-value=1e-10; |
| Length | 399 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | AAGAGAAAAACTTGACCATGTTTCAAGATCAAACAACATTAAACACCATCAGTCCCAACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828881 |
| Trichome-related Gene from Literature | N/A |