| Detail of EST/Unigene CX520316 |
| Acc. | CX520316 |
| Internal Acc. | s13dNF40C02VI006_444684 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Quinone oxidoreductase-like protein At1g23740, chloroplastic OS=Arabidopsis thaliana E-value=7e-60; Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Dictyostelium discoideum E-value=1e-08; Protein TOXD OS=Cochliobolus carbonum E-value=2e-08; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=2e-08; |
| Length | 498 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | GTAAAGGACTTCAAAGTTGGTGATGAAGTGTATGGTGATGTAAATGAGAAAGCATTAGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838984 |
| Trichome-related Gene from Literature | N/A |