Detail of EST/Unigene CX520334 |
Acc. | CX520334 |
Internal Acc. | s13dNF40D10VI090_444720 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--NADP reductase, leaf isozyme, chloroplastic OS=Pisum sativum E-value=2e-65; Ferredoxin--NADP reductase, chloroplastic OS=Vicia faba E-value=5e-64; Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic OS=Arabidopsis thaliana E-value=9e-62; Ferredoxin--NADP reductase, chloroplastic OS=Mesembryanthemum crystallinum E-value=4e-61; Ferredoxin--NADP reductase, chloroplastic OS=Spinacia oleracea E-value=6e-61; |
Length | 566 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GTTCAATGGTTTGGCATGGCTCTTCTTGGGTGTCCCCACAAGCAGCTCACTGCTTTATAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.16.1.8 1.6.2.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836751 |
Trichome-related Gene from Literature | N/A |