| Detail of EST/Unigene CX520399 |
| Acc. | CX520399 |
| Internal Acc. | s13dNF51C09VI066_448584 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=1e-96; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=1e-69; 50S ribosomal protein L22, chloroplastic OS=Solanum lycopersicum E-value=3e-36; 50S ribosomal protein L22, chloroplastic OS=Solanum bulbocastanum E-value=3e-36; 50S ribosomal protein L22, chloroplastic OS=Solanum tuberosum E-value=7e-36; |
| Length | 578 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF; |
| Sequence | ATGGCTCTTTCTTTAACCGCCATTAACCTTCCTCCTCCTCCTGTTCGCGATAACGCACTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |