Detail of EST/Unigene CX520497 |
Acc. | CX520497 |
Internal Acc. | s13dNF55E02VI007_448780 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 54S ribosomal protein L19, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-29; 39S ribosomal protein L11, mitochondrial OS=Homo sapiens E-value=2e-26; 39S ribosomal protein L11, mitochondrial OS=Rattus norvegicus E-value=7e-26; 39S ribosomal protein L11, mitochondrial OS=Bos taurus E-value=9e-26; 50S ribosomal protein L11 OS=Blochmannia floridanus E-value=1e-25; |
Length | 423 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF; |
Sequence | GTGGGACCTGCGCTAGGTCAGTACCGACTGAACCTTATGGCTTTCTGCAAAGACTTCAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829701 |
Trichome-related Gene from Literature | N/A |